Forum Entomologiczne - Chrząszcze i Motyle Polski - strona główna

Polskie Forum Entomologiczne

PFEnt. - http://www.entomo.pl/forum/
Teraz jest wtorek, 21 lis 2017, 18:10

Strefa czasowa: UTC + 1




-----------------------------------------------------------------------------------------------------------------------------
|     Prosimy o podawanie miejsca i daty obserwacji. To przyśpieszy oznaczenie i ułatwi dyskusję.     |
-----------------------------------------------------------------------------------------------------------------------------

Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 55 ] 
Autor Wiadomość
 Tytuł: Sekwencjonowanie DNA, kariotyp, chromosomy - procedury, przygotowania.
PostNapisane: środa, 20 lip 2011, 13:35 
Offline

Dołączył(a): czwartek, 5 lut 2004, 02:00
Posty: 1910
Lokalizacja: Palearktyka
Specjalność:
Wydzielone z wątku viewtopic.php?f=131&t=19321

Bo ja wiem? Tutaj akurat cechą jest kariotyp, też możesz sobie obejrzeć i porównać chromosomy. A i sekwencjonowanie możesz sobie zrobić ręcznie, bez żadnych komputerów. Zamiast primerów fluorescencyjnych bierzesz radioaktywne, produkty reakcji puszczasz na zwykłym żelu sekwencyjnym (a nie w kapilarach sekwenatora), robisz tradycyjny radiogram i ręcznie spisujesz sekwencję z kliszy za pomocą linijki i ołówka (lub studenta, jeśli dysponujesz tak zaawansowanym narzędziem). Jeszcze paręnaście lat temu tak się robiło i też było dobrze. Wszystko widać gołym okiem, żadnej wielkiej techniki, komputerów itd. A jeszcze wcześniej duża część systematyki np. wątrobowców była oparta na metodach immunoelektroforetycznych, tam też identyfikacja zależała przede wszystkim od prążków na żelu. Systematyka jednokomórkowców to już prawie tylko cechy biochemiczne i genetyczne (zresztą w bakteriach cechy biochemiczne i fizjologiczne o wiele lat wyprzedziły jakiekolwiek cechy morfologiczne). Długo by wymieniać.

Paweł


Share on FacebookShare on TwitterShare on Google+
Góra
 Zobacz profil  
 
 Tytuł: Re: Leptidea juvernica, nowy gatunek bielinka w Europie
PostNapisane: środa, 20 lip 2011, 14:18 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Pawel Jaloszynski napisał(a):
Tutaj akurat cechą jest kariotyp, też możesz sobie obejrzeć i porównać chromosomy. A i sekwencjonowanie możesz sobie zrobić ręcznie, bez żadnych komputerów. Zamiast primerów fluorescencyjnych bierzesz radioaktywne, produkty reakcji puszczasz na zwykłym żelu sekwencyjnym (a nie w kapilarach sekwenatora), robisz tradycyjny radiogram i ręcznie spisujesz sekwencję z kliszy za pomocą linijki i ołówka (lub studenta, jeśli dysponujesz tak zaawansowanym narzędziem). Jeszcze paręnaście lat temu tak się robiło i też było dobrze. Wszystko widać gołym okiem, żadnej wielkiej techniki, komputerów itd.
Paweł


Wlaśnie interesuje mnie jak to sie robi, czyli odrobina praktyki, bo czytanie opisów nie daje mi poczucia zrozumienia. Fakt, że zainteresowalem się tym niedawno.

Potrzebna byłaby praca
    Rozek, M. 2004. A new chromosome preparation technique for Coleoptera (Insecta). Chromosome Research, 2 (1): 76-78.

Może ktoś ją posiada? Albo inną, opisującą te zagadnienia.

Opisana tam metoda wygląda mniej więcej następująco (wg. Okutaner, 2011):

The specimens were placed in killing-jar with ethyl acetate to anaesthetize. Abdomens of the specimens were cut and abdominal contents (especially testicle tissue in males, and middle-gut tissue in males and females) were transferred in petri dishes with distilled water. So the tissues were sustained on hold for 10-15 minutes in the hypotonic solution. They were transferred cryotubes with 0.05 % cholcicine solution and were maintained for 45-60 minutes in room temperature and then, fixed in 3:1 fresh ethanol-acetic acid solution for at least 1 hour. Small pieces from the treated tissues were taken and mounted on a clear lam. On tissue pieces were dropped 45 % acetic acid and were dissected with using dissection pins and bisturi. Then, tissue pieces were mounted and pressed directly between lam and lamel or lam and lam. These preparates were submerged into liquid nitrogen. Lam and lamel or lam and lam were uncoupled and left for drying. Later, the dry preparates were stained by 4 % Giemsa Phosphate Buffer (pH = 6.8) for 10 minutes and were washed with distilled water. After drying the preparates were examined under stereo microscope (Leica DMLB). The observed plaques were photographed zoom in (10X).(100X).

Kolejność byłaby taka (i tu od razu pytania):

    zanurzenie w octanie etylu (po co?)
    roztwór hipotoniczny - chodzi o "napęcznienie", czyli pociągniecie wody?
    trzymane przez około 60 min w temp pokojowej w "cholcicine"... o co chodzi?
    kapiel godzinna w świeżym octanie octowym (ethanol-acetic acid) - co to jest i znów - po co?

potem jeszcze parę procesów ... jak to się robi, co jest potrzebne.
Czy jest gdzies jakis proste FAQ, tutorial, jak się do tego zabrać.

Załączam graficzny obraz procesów z pracy Okutaner et all, 2010. SOME CYTOGENETIC OBSERVATIONS OF TWO DORCADION DALMAN, 1817 SPECIES.....


Załączniki:
methods cytogenetics.gif
methods cytogenetics.gif [ 68.74 KiB | Przeglądane 6668 razy ]
Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosmy
PostNapisane: środa, 20 lip 2011, 14:46 
Offline

Dołączył(a): poniedziałek, 11 lip 2011, 19:23
Posty: 76
Lokalizacja: Beskid Śląski
UTM: CA61
Specjalność:
Chodzi o kolchicynę. Jeśli dobrze pamiętam to niszczy wrzeciona kariokinetyczne i zatrzymuje podział komórkowy na jakimś etapie (metafaza?).


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosmy
PostNapisane: środa, 20 lip 2011, 19:12 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 2 lip 2009, 14:22
Posty: 1145
Lokalizacja: Poland, Gdynia CF34
UTM: CF 34
Specjalność:
Cytuj:
świeżym octanie octowym (ethanol-acetic acid)


tu może chodzić o mieszaninę etanol-kwas octowy
w takiej mieszaninie powstaje na skutek reakcji octan etylu i pozostaje w równowadze z substratami
jaki jest skład takiej mieszaniny zależy od stałej równowagi reakcji i temperatury, od której ta stała jest zależna
to tak od chemika

Paweł


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosmy
PostNapisane: środa, 20 lip 2011, 19:55 
Offline

Dołączył(a): poniedziałek, 12 kwi 2004, 10:26
Posty: 246
Lokalizacja: Wrocław
Specjalność:
palipa napisał(a):
w takiej mieszaninie powstaje na skutek reakcji

W tych warunkach i czasie w tej mieszaninie nic nie powstaje. Chodzi po prostu o utrwalenie tkanek.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosmy
PostNapisane: środa, 20 lip 2011, 20:12 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 2 lip 2009, 14:22
Posty: 1145
Lokalizacja: Poland, Gdynia CF34
UTM: CF 34
Specjalność:
na pewno powstanie, kwestia ilości


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosmy
PostNapisane: środa, 20 lip 2011, 21:27 
Offline

Dołączył(a): czwartek, 5 lut 2004, 02:00
Posty: 1910
Lokalizacja: Palearktyka
Specjalność:
W dużym uproszczeniu:

Podział komórki przebiega poprzez kilka etapów. Chromosomy zaczynają być widoczne w profazie, ale optymalnym etapem do ich obserwacji jest metafaza, podczas której są one duże, grube i wygodnie dla obserwatora ustawiają się w płaszczyźnie równikowej komórki. Taki układ nazywany jest płytką metafazową. Do chromosomów przyczepione są też wtedy włókna wrzeciona podziałowego - w następnym etapie te włókna zaczną przeciągać chromosomy do przeciwległych biegunów i ostatecznie w ten sposób powstaną dwa jądra i dwie komórki.

Nawet w gruczołach rozrodczych wcale nie tak dużo komórek dzieli się intensywnie. W dodatku te, które to robią, są na różnych etapach podziału. Więc trzeba coś zrobić, żeby w preparacie zrobionym z tkanki nie było akurat tak, że w ogóle nie zobaczymy płytek metafazowych, albo będzie ich bardzo mało czy też słabej jakości. Na szczęście znane są substancje, które potrafią "sparaliżować" wrzeciono podziałowe w taki sposób, że podział dochodzi do metafazy i tutaj się zatrzymuje. Jeśli więc weźmiemy żywą tkankę i podziałamy na nią np. kolchicyną lub kolcemidem, wtedy po pewnym czasie wszystkie dzielące się komórki dojdą do metafazy i na tym etapie się zatrzymają. Czyli mamy dużo więcej płytek metafazowych do obserwacji. Teraz preparat się utrwala (czyli zabija), barwi i ogląda.

W praktyce, bezpośrednio nawiązując do protokołu przytoczonego przez Jacka:

1. Znieczula się owada (nie zabija, tylko ostrożnie usypia, żeby się nie ruszał, ale nie wyzionął ducha). Można to zrobić octanem etylu, aczkolwiek to metoda ryzykowna, bo można zabić lub uszkodzić interesujące nas tkanki. Częściej robi się to po prostu dwutlenkiem węgla.

2. Odrywa się odwłok. W odwłoku znajdują się gruczoły rozrodcze, a więc jest największa szansa na dużo komórek będących w trakcie podziałów.

3. Etapu z wodą nie rozumiem, normalnie w przypadku np. ludzkich limfocytów żywe, dzielące się komórki traktuje się kolcemidem bez takich cyrków. Ale są różne warianty postępowania w przypadku różnych tkanek i organizmów, być może dla owadów wstępne spęcznienie tkanki roztworem hipotonicznym czy po prostu wodą poprawia wyniki. To już są jakieś drobiazgi metodyczne, mało istotne dla samej zasady. Może to być też błąd opisu, patrz punkt 5.

4. Tkankę traktuje się kolcemidem (lub innym tego typu preparatem) przez jakiś czas.

5. Zwykle tutaj następuje kąpiel w płynie hipotonicznym, właśnie po to, żeby "rozpulchnić" komórki, co bardzo poprawia jakość preparatów.

6. Materiał trzeba teraz utrwalić. Typowym utrwalaczem jest mieszanina etanolu (lub metanolu) z kwasem octowym. Oczywiście octan etylu nie ma tu nic do rzeczy, taka mieszanka ma po prostu dobre właściwości utrwalające (alkohol ma tendencję do obkurczania preparatu, kwas octowy temu zapobiega).

7. Utrwaloną tkankę rozgniata się na szkiełku mikroskopowym, barwi za pomocą barwnika Giemsy, suszy i ogląda pod olejkiem immersyjnym.

Paweł


Góra
 Zobacz profil  
 
 Tytuł: DNA - probki, metody
PostNapisane: środa, 11 lip 2012, 14:41 
Offline

Dołączył(a): środa, 9 maja 2012, 15:22
Posty: 125
Lokalizacja: Inowrocław
UTM: CD14
Specjalność:
Nie jestem chrząszczarzem ale mam pewną wątpliwość dotyczącą doklejania czułków i odnóży. W jednym z ostatnich badań rodziny Coleophoridae (Microlepidoptera) ustalano pokrewieństwo gatunków na podstawie analiz DNA. Tylko że próbę tkanek do badań pobierano z jednego z odnóży. Co by było gdyby to doklejone odnoże nie zgdzało się z genotypem okazu głównego. Nigdy nie wiadomo czy ktoś nie rozdzieli gatuku na dwa na podstawie jakiejś kropki na nodze. Jest jeszcze inny problem. Kleje stosowane do doklejania są przeważnie pochodzenia organicznego to też może powodować przekłamania. Oświeccie mnie prosze. Pozdrawiam


Góra
 Zobacz profil  
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: środa, 11 lip 2012, 17:38 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
tomasz Rynarzewski napisał(a):
ustalano pokrewieństwo gatunków na podstawie analiz DNA. Tylko że próbę tkanek do badań pobierano z jednego z odnóży. Co by było gdyby to doklejone odnoże nie zgdzało się z genotypem okazu głównego.

Do badań DNA zabezpiecza się tylko żywe okazy dlatego o doklejaniu nóżek nie może być mowy. Poza tym badacz sam powinien najlepiej wiedzieć jakim materiałem dysponuje. Ponadto wszelkie próby doklejania są widoczne i trudno tego nie zauważyć pod odpowiednim powiększeniem.

PS. A czy to pytanie nie powinno znaleźć się całkiem w osobnym temacie?  :shock:


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: środa, 11 lip 2012, 19:10 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Jacek do badań DNA używa się nie tylko żywych okazów ale również mrożonych lub z 98% alkoholu.


Góra
 Zobacz profil  
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: środa, 11 lip 2012, 19:25 
Offline
Avatar użytkownika

Dołączył(a): niedziela, 19 gru 2004, 15:14
Posty: 1930
Lokalizacja: Rzeszów
Specjalność: Psychidae
Grzegorz Banasiak napisał(a):
Jacek do badań DNA używa się nie tylko żywych okazów ale również mrożonych lub z 98% alkoholu.


mokrych, suchych, żywych jak i martwych. Każdych.

Zwykle się bierze element, którego najmniej będzie brakowało - np. tylna nóżka, zatem jeśli była doklejona - to wynikiem badań będzie kupa śmiechu  :laugh:
Swego czasu słyszałem radę z czego dorabiać czułki egzotycznym motylom - otóż z włosa wydartego z miotły kuchennej z obitą młotkiem końcówką żeby imitowała buławkę. Swoją drogą do gabloty wiszącej na ścianie - idealne rozwiązanie. :laugh:


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: środa, 11 lip 2012, 19:35 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Grzegorz Banasiak napisał(a):
Jacek do badań DNA używa się nie tylko żywych okazów ale również mrożonych lub z 98% alkoholu.

Tak, chodzi o zabezpieczone w alkoholu okazy, które są do niego wrzucane, kiedy są jeszcze żywe. O to mi wlaśnie chodziło - o zabezpieczanie żywych okazów a nie używanie przy zabezpieczaniu okazów juz martwych, suchych. Mają być bez żadnych zanieczyszczeń, świeże zakonserowowane komórki. Tak zabezpieczam okazy do badań DNA wg wytycznych, dlatego wydało mi się dość niedorzeczne, aby pracować na okazach suchych z doklejanymi odnóżami  :laugh:

PS. procedura przygotowania owada (tkanek) do badań DNA została w skrócie przedstawiona przez Pawła Jałoszyńskiego kilka postów wyżej: viewtopic.php?p=138997#p138997


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 08:55 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Jest możliwa ekstrakcja DNA z okazów suchych, czasem nawet bardzo starych. Ale niestety często nic z tego nie wychodzi albo DNA jest strasznie poszatkowane i trzeba je "sklejać" np mikrosatelitami, co jest procesem długim, trudnym i drogim. Niedawno powastała u mnie w zakładzie praca na temat ekstrakcji DNA z okazów zakonserwowanych klasycznymi metodami i wyszło z tego że się da, ale najlepsze efekty daje ekstrakcja z okazów stosunkowo "młodych" (do 20 lat) i stosunkowo dużych (badane były jakieś tarczówki zdaje się).

Próbowaliśmy z Danielem Kubiszem i naszym genetykiem wyciągać DNA ze starych, muzealnych okazów i momentami się udawało, ale to straszna loteria, można się pobawić jak ktoś ma kase i długie serie. Ryzykowanie czegoś takiego np. z typami to istne szaleństwo, choć my już mamy wprawę w skutecznym wyciąganiu DNA ze starszych okazów i pozostawieniem nieuszkodzonego okazu. Udawało się na chrząszczaach pokroju Agrilusów czy Anthaxi.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 08:57 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Miłosz, czyli z jakich okazów powinno robić się (i robi) DNA w badaniach?


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 09:03 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Miłosz Mazur napisał(a):
Jest możliwa ekstrakcja DNA z okazów suchych, czasem nawet bardzo starych. Ale niestety często nic z tego nie wychodzi albo DNA jest strasznie poszatkowane i trzeba je "sklejać" np mikrosatelitami, co jest procesem długim, trudnym i drogim. Niedawno powastała u mnie w zakładzie praca na temat ekstrakcji DNA z okazów zakonserwowanych klasycznymi metodami i wyszło z tego że się da, ale najlepsze efekty daje ekstrakcja z okazów stosunkowo "młodych" (do 20 lat) i stosunkowo dużych (badane były jakieś tarczówki zdaje się).

Próbowaliśmy z Danielem Kubiszem i naszym genetykiem wyciągać DNA ze starych, muzealnych okazów i momentami się udawało, ale to straszna loteria, można się pobawić jak ktoś ma kase i długie serie. Ryzykowanie czegoś takiego np. z typami to istne szaleństwo, choć my już mamy wprawę w skutecznym wyciąganiu DNA ze starszych okazów i pozostawieniem nieuszkodzonego okazu. Udawało się na chrząszczaach pokroju Agrilusów czy Anthaxi.

Miłosz, może napisałbyś parę zdań o samym procesie - nie tyle wyciągania DNA - co jego dalszej obróbki aż do efektu końcowego. Kiedyś Paweł Jałoszyński wspominał, że można to zrobić nawet "domowymi" metodami ale nawet nie jestem pewien czy dobrze go zrozumiałem.


Góra
 Zobacz profil  
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 11:22 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Sama procedura jest prosta. Należy zakupić zestaw do izolacji DNA, zwykle na 50 próbek starcza, koszt 500-700 PLN zaleznie od tego co analizujemy (tyle kosztuje standardowy zestaw do owadów, podejrzewam że taki do mikrosatelitów jest dużo droższy, ale się nie orientuję bo sam go nigdy nie kupowałem). Tam idziemy wg instrukcji krok po kroku, dodaj, zamieszaj, zwiruj, odsącz, potem PCR itd... prosta sprawa. Otrzymujemy ekstrakt DNA z którego izoluje się łańcuchy różnej długości (mierzy się to liczbą par zasad). Standardowa metoda to elektroforeza na żelu poliakryloamidowym. Bierze się "tabliczkę" takiego żelu, i w wycięte "kieszonki" wlewa się pipetom niewielką ilość ekstraktu. Całość umieszcza w pojemniku z buforem i podłącza dwie elektrody o własciwym natężeniu (zwykle kilkadziesiąt miliamperów) i czeka. Dostajemy w efekcie żel z poprzecznymi paseczkami gdzie są sekwencje o danej długości (chyba każdy widział, choćby w filmach). Całość jest wcześniej barwiona, zwykle błękitem bromoetylowym (uwaga - trucizna) i można to oglądać w świetle UV. Poszczególne "paseczki" wycina się skalpelem i do fiolki, całość zalewa się jeszcze odpowiednim buforem.
Takie coś idzie do sekwencjonowania, ale to już robi maszyna, często komercyjne firmy oferują takie usługi, i dostajemy wynik w postaci wykresów czy tabel z ciągiem CATTTCCAGGGACTAGGGCCAAATATA .... itd...

Metoda żelowa jest prosta i skuteczna choć można też stosowac do tego chromatografię cienkowarstwową, jednak sam nigdy tego nie robiłem i nie spotkałem w publikacjach się by ktoś to stosował do owadow.

Moje tłumaczenie pewnie sprowadziło by na mnie gromy PJ, ale tak w skrócie to wygląda ;)

Oczywiście metodyka tego czy analizujemy DNA z jąder czy mitochondriów, jakie barwniki, startery inicjujące reakcje PCR itd. to wielka wiedza i nie jedną ksiażkę jej poświęcono. Wszystko zależy od tego po co to robimy i co mamy badać. Często wychodzą różne problemy (np. przy gatunkach partenogenetycznych czy triploidach) ale można to ominąć.

Jakby kogoś interesował ten temat to polecam dwie książki:

Przykłady analiz DNA pod redakcją Słomskiego (wyd. AR w Poznaniu) - podręcznik metodyczny do różnego typu analiz
Ekologia molekularna autorstwa J.R. Freeland (PWN) - dużo lepsza, bo dokładnie pisze jak możemy te metody wykorzystać: analiza populacji, identyfikacja gatunków, filogeografia itd.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 13:40 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Jacek Kurzawa napisał(a):
Miłosz, czyli z jakich okazów powinno robić się (i robi) DNA w badaniach?


Najlepiej żywcem wrzuconych do alkoholu etylowego (99% cz.d.a.) w terenie. My wyciągamy też z suchych materiałów muzealnych, ale tu jest różnie. W przypadku dużych okazów można oderwac np. tylną nogę gdzie jest szansa, że zachowało się więcej mięśni, ale z mniejszymi to wrzucamy go całego do eksttrakcji, a potem go powtórnie przeklejamy.

Gigantyczna wada wielu prac genetycznych to całkowite zniszczenie okazu który był wzięty do badań bo takie oznaczenie jest potem nieweryfikowalne, a przy obecnych zmianach w systematyce nawet znanych gatunków nie będzie się miało pewności z czym naprawdę mieliśmy do czynienia. Jeśli ekstrachuje się z DNA z części jakiegoś owada to nie zachowujemy najczęściej tego elementu, ale zawsze zaznaczamy dodatkową etykieta w gablocie, że cos tam mu zabraliśmy i do czego. Aby zawsze można było skojarzyc konkretny okaz z wynikami.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 12 lip 2012, 14:32 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Miłosz Mazur napisał(a):
Jacek Kurzawa napisał(a):
Miłosz, czyli z jakich okazów powinno robić się (i robi) DNA w badaniach?


Najlepiej żywcem wrzuconych do alkoholu etylowego (99% cz.d.a.) w terenie.


I właśnie o to mi chodziło. Wiadomo, że te okazy w trakcie badań są już martwe, ale zabezpieczane były jako żywe.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 06:16 
Online
Avatar użytkownika

Dołączył(a): środa, 14 gru 2011, 10:29
Posty: 1083
Specjalność:
Skąd wytrzasnęliście takie stężenie etanolu (98-99%) do utrwalania materiału pobranego z terenu?  :shock:  :shock: Przyznam, że nie spotkałem sie z protokołami utrwalania materiału do badań DNA w których stężenie etanolu jest tak wysokie. Ale chętnie bym sie zapoznał z nimi.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 07:37 
Online

Dołączył(a): wtorek, 25 maja 2004, 12:36
Posty: 815
Specjalność:
Przemku, mój syn na uniwersytecie w Davis pracuje właśnie w laboratorium badań DNA mrówek. Robi wszystkie te procedury, o których pisze Miłosz plus sekwencje w sekwenatorze DNA. Jako materiał do badań używa tylko mrówki zbierane w terenie do 99% alkoholu. Jak zbieram materiały dla niego w Europie to zawsze mam trochę probówek z takim alkoholem, aby móc w każdej chwili interesujący go rodzaj zakonserwować w takim super stężonym alkoholu (sam zbieram mrówki do 75% alkoholu, bo są wtedy łatwiejsze do preparacji, nie sztywnieją tak mocno). Próbował on izolować DNA również ze starszych naszych okazów konserwowanych w standardowym alkoholu skażonym i były różne efekty, od bardzo dobrych do kiepskich. Z każdym tygodniem przechowywania mrówek nawet w stężonym alkoholu DNA się degraduje, więc staram się wysyłać mu nowe materiały nie później niż do miesiąca od momentu złowienia. Izolacji DNA z suchych materiałów muzealnych w ogóle już nie stosują, bo wyniki okazywały się totalną loterią. Oczywiście można też zbierać do ciekłego azotu, ale mało kogo stać na bieganie po terenie z termosem do zamrażania, choć podobno taki materiał jest najtrwalszy.
Dla mnie ważniejsza była refleksja jego szefa po dwuletnich badaniach molekularnych w tym laboratorium. Stwierdził on, że gdyby te wszystkie pieniądze, które przerobili na te badania poświęcić na tradycyjne studia taksonomiczne nad mrówkami, to efekt zarówno od strony ilościowej jak i na poziomie rozważań filogenetycznych pewnie by był dużo lepszy. Ale w USA prace taksonomiczne bez analiz molekularnych też uważane są za "przestarzałe" więc, żeby laboratorium dostawało granty na badania to trzeba sporą część kasy na DNA poświęcić.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 08:16 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
No stety/niestety takie trendy. Tylko skąd brać ten materiał w alkoholu? Wiem że niektóre muzea przestawiają się na materiały alkoholowe i tworzą zbiory w fiolkach. Jednak w klasycznej taksonomi bazującej na materiałach muzealnych nie ma opcji ryzykowania zniszczenia typu tylko po to by ryzykowac wyciąganie z niego DNA. Ściągam teraz sporo materiałów z Australii i Oceanii i już w trzech przypadkach materiałów z Fidżi, Australii i Nowej Zelandii dostaję materiał w alkoholu. Coraz częściej odchodzi się od preparowania w przypadkach dużego materiału np z zamgławiania i pakują to wszystko w wódę. Oszczędność czasu i środków ogromna. Tyle że ten materiał potem jest różny, traci barwy, niektóre struktury genitalne są potem zwichrowane no i znowu kłopot...

Dodam jeszcze od siebie, że materiał pobrany w terenie do alkoholu na potrzeby badań DNA musi być przechowywany w lodówce. Teoretycznie powinno być to ok -70stC aby materiał zachował się jak najdłużej, jednak my stosujemy laboratoryjne zamrażarki trzymające ok minus 22-25stC i nawet po roku-dwóch nie ma problemy z wyciągnięciem DNA i jest on w dobrym stanie. Ostatecznie trzymamy to w normalnych, "domowych" zamrażalnikach i nawet po kilku miesiącach nie ma problemów z wynikami.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 11:10 
Online
Avatar użytkownika

Dołączył(a): środa, 14 gru 2011, 10:29
Posty: 1083
Specjalność:
Właśnie o degradacji DNA w wysoce stężonych alkoholach słyszałem. W zasadzie jak wrzucimy parę okazów do 99% to już po chwili nie jest 99% bo się rozcieńcza płynami ustrojowymi :-) W odniesieniu do wielu organizmów zbyt stężony alkohol powoduje zbyt szybką denaturację białek powierzchniowych i wytworzenie takiej szczelnej kapsuły uniemożliwiającej dalszą penetrację alkoholu w głąb, stąd materiał może się czasami psuć dużo szybciej.
Ciekawe. Pracowałem trochę ( w zasadzie pracuje dalej) z materiałem genetycznym ale mikroorganizmów, stad moje zaciekawienie, bo spotkałem się z tym pierwszy raz (mam na myśli tak stężony etanol). A PCR nie jest mi obcą metodą. Fakt specyfika badań inna to i inne protokoły i odmienne postępowanie. Chociaż jak zauważyłeś Lechu sporą ilość badań molekularnych można by pominąć i przerzucić fundusze w całkowicie innym kierunku, z korzyścią. Kiedyś na studiach doktoranckich i stypendium tłukłem te PCR y zwane ,,pisuarami" do obłędu - puszczałem nawet 2-3 reakcje dziennie przez parę dobrych lat, by dojść do wniosku, że to tylko metoda ze wszelakimi plusami i minusami, obarczona sporym marginesem błędu wyznaczanym przez wiele czynników z człowiekiem na czele. Chociaż w wielu przypadkach istotnie niezastąpiona.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 11:26 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Mikroby to zupełnie inna bajka, tam morfologia to zaledwie wskazówka, co zresztą pokreślił Paweł w pierwszym poście w tym wątku.

Z tym rozcieńczaniem to fakt, dlatego jak jest dużo materiału w fiolce to się ten alkohol wymienia na nowy często.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 13:36 
Offline

Dołączył(a): środa, 9 maja 2012, 15:22
Posty: 125
Lokalizacja: Inowrocław
UTM: CD14
Specjalność:
A powiedzcie skąd się biorą (w badaniach DNA) czasami takie dziwne wyniki, że nagle w jednej grupie gatunków pojawia się gatunek, który był dotychczas w innej grupie i to dość odległej, np. w grupie z pojedynczym edeagusem pojewia się gatunek z podwójnym edeagusem charakterystycznym dla innej grupy gatunków. Sprawdzałem larwy tych gatunków i te które miały pojedynczy edeagus nie mają w ogóle płytek grzbietowych na zatułowiu a ten gatunek z podwójnym edeagusem ma płytki na zatułowiu(przykład w Coleophoridae w Lepidoptera). Morfologicznie zupełnie inna bajka.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 13:46 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Genetycy rzadko kiedy patrza na morfologię i geny to dla nich jedyna wyrocznia, ot co.

Jest sporo prac, gdzie genetycy bez wiedzy o systematyce i morfologii grupy brali się za taksonomię i tylko zamęt wprowadzili.

Choc jeżeli wyszło im coś kontrowersyjnego to powinni się z tego przynajmniej wytłumaczyć, a z tym jest różnie.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: piątek, 13 lip 2012, 13:58 
Online
Avatar użytkownika

Dołączył(a): środa, 14 gru 2011, 10:29
Posty: 1083
Specjalność:
Tak MIłosz słusznie prawi - geny a reszta takich bzdur jak morfologia to olać. Zakładając, że mogą wyjść genetykom bzdury bo metody te sa obarczone sporym marginesem błędu, możemy mieć cudaczne wygibasy taksonomiczne. Ale często liczy sie publikacja i indeks cytowań niż merytoryczna zawartość artykułu.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Zdjęcia zbiorów - Kózkowate (Col., Cerambycidae)
PostNapisane: czwartek, 20 sie 2015, 11:46 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Miłosz Mazur napisał(a):
Jacek Kurzawa napisał(a):
Miłosz, czyli z jakich okazów powinno robić się (i robi) DNA w badaniach?


Najlepiej żywcem wrzuconych do alkoholu etylowego (99% cz.d.a.) w terenie.



Odświeżę temat - skąd wziąć taki alkohol? Czy to taki? (widzę że taki, ale wolę dopytać):
http://sklep.labglass.pl/Alkohol-etylowy-99-8-CZDA-500ml(4,1063,3467).aspx
http://www.katalogalchem.pl/etylowy-alkohol-bezwodny-etanol-998-czda-id-2177.html

Litr kosztuje około 160 zł.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 20 sie 2015, 14:21 
Online

Dołączył(a): wtorek, 25 maja 2004, 12:36
Posty: 815
Specjalność:
Tak, to taki alkohol. Kiedyś sprzedawano go nawet w aptekach.
Wracając do tematu, od mojego wpisu z 13 lipca 2012 wiele się w metodyce badań zmieniło. Mój syn dalej na Uniwersytecie Kalifornijskim w Davis pracuje w laboratorium DNA, ale w tej chwili do badań nie muszą już mieć materiału przechowywanego w alkoholu absolutnym. Robią analizy i ze zwykłych materiałów z 75% alkoholu jak i z suchych mrówek na szpilkach. Mają procedury na długie sekwencje genów jądrowych, mitochondrialnych i rybosomowych. Czułość nowych procedur i używanych starterów pozwala na dość dokładne izolowanie i sekwencjonowanie DNA z różnych materiałów. Zdarzają się niewypały, ale stosunkowo rzadko. Ja zbieram mrówki do 75% alkoholu, ale robionego wyłącznie z alkoholu absolutnego. Ten skażony, powszechnie używany na uczelniach ma kilka wad. Przede wszystkim powoduje znacznie większe sztywnienie okazów, a jeżeli zbierane próby są wielogatunkowe (np. na upatrzonego, a nie z prób gniazdowych), to częściej zdarza się, że startery nie załapują DNA gatunku na którym nam zależy, ale sąsiada z probówki. Wygląda na to, że substancje skażające alkohol przyśpieszają też macerację okazów.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 20 sie 2015, 14:26 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Temat wydaje się na tyle ciekawy, że warto go rozwijać. Metodyka "domowo-ręczna" bez super drogiego sprzętu mnie osobiście bardzo interesuje, na razie na etapie ogólnym ale w przyszłości kto wie, może spróbuję coś takiego zrobić. Opis pierwotnie podany przez Pawła brzmi zachęcająco. Zapewne aż tak łatwo nie jest, w każdym razie wiedzieć co i jak - zawsze warto.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 20 sie 2015, 14:37 
Offline

Dołączył(a): piątek, 7 sty 2011, 19:33
Posty: 57
Lokalizacja: Opole
Specjalność:
Dla zainteresowanych link do starszych prac na pluskwiakach z użyciem metod
biologii molekularnej i bioinformatyki:
http://www.cydnidae.uni.opole.pl/show.php?id=44&lang=en


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 20 sie 2015, 21:56 
Offline
Avatar użytkownika

Dołączył(a): niedziela, 19 gru 2004, 15:14
Posty: 1930
Lokalizacja: Rzeszów
Specjalność: Psychidae
Lech Borowiec napisał(a):
... ale w tej chwili do badań nie muszą już mieć materiału przechowywanego w alkoholu absolutnym. Robią analizy i ze zwykłych materiałów z 75% alkoholu jak i z suchych mrówek na szpilkach.

Nawiązując do porównania marynaty alkoholowej vs. suchych okazów... kilkakrotnie wysyłałem do badań genetycznych suche okazy zabite do kilku lat wcześniej i to wystarczało, wyniki były ok. Co więcej, nie zwracano mi uwagi aby była potrzeba wysyłania alkoholowych okazów, a wystarczała zwykła sucha tylna noga motyla.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: niedziela, 6 gru 2015, 20:08 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Lech Borowiec napisał(a):
Ten skażony, powszechnie używany na uczelniach ma kilka wad. Przede wszystkim powoduje znacznie większe sztywnienie okazów, a jeżeli zbierane próby są wielogatunkowe (np. na upatrzonego, a nie z prób gniazdowych), to częściej zdarza się, że startery nie załapują DNA gatunku na którym nam zależy, ale sąsiada z probówki. Wygląda na to, że substancje skażające alkohol przyśpieszają też macerację okazów.

Pociągnę pytanie dalej, ponieważ litr czystego alkoholu to koszt ok 180 zł a tego skażonego zaledwie 16 zł.
http://allegro.pl/rozpuszczalnik-spiryt ... 83432.html
Jest to:
Alkohol etylowy 99,9%
metyloetyloketon 1l/100 dm³
benzoesan denatonium 1g/100 dm³

czyli 1/100 częsci metyloetyloketonu oraz 0,01 grama benzoesan denatonium. Domieszki są więc bardzo niewielkie.

I teraz własciwie pytanie: jeśli chciałbym przechowywać larwy pojedynynczo - jedna w probówce - to na ile te zanieczyszczenia mogą wpłynąć na pogorszenie wyników badań DNA?


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 08:44 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Trzeba by to pewnie sprawdzić doświadczalnie.
Ja z ekipą już kilka razy rozważaliśmy wykorzystanie tańszych substytutów alkoholu etylowego cz.d.a.
W sumie nie zdecydowaliśmy się bo jednak pewne ryzyko istnieje.
Można by stosunkowo łatwo sprawdzić jak zachowują się okazy po przechowywaniu w różnych warunkach, jednak jest to pewien koszt na ewentualnie zmarnowane próbki i odczynniki.
Te niewielkie ilości innych substancji mogą nawet nie mieć wpływu na samo DNA, ale mogą wchodzić w reakcję z enzymami i odczynnikami stosowanymi podczas ekstrakcji i obróbki materiału, mogło by się coś spieprzyć podczas podgrzewania, nie wiemy czy w jakiś sposób ni zaburzyło by wyników... Zbyt wiele tych niewiadomych by ryzykować na badawczym materiale no i kto zaryzykuje poświęcenie na to kasy, choć wyniki dało by się pewnie nawet nieźle opublikować (jeżeli dotychczas ktoś już tego nie robił; albo zrobił i nie opublikował wyników bo nie wyszło nic wartego uwagi...).
Poza tym zawsze jest ryzyko, że coś się zepsuje podczas długotrwałego przechowywania materiału. Samo wrzucenie okazu do alkoholu w terenie i potem przebadanie go za jakiś krótki czas może nie dać żadnego negatywnego efektu, ale co się będzie działo z tym materiałem po roku przechowywania w lodówce?
Nikt chyba nie wie ;)


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 09:13 
Offline

Dołączył(a): piątek, 7 sty 2011, 19:33
Posty: 57
Lokalizacja: Opole
Specjalność:
Zainteresowane tematyką osoby mogą zapoznać się z wielokrotnie wypróbowaną metodyką
z użyciem alkoholu etylowego jednak cz.d.a po ściągnięciu pełnego tekstu:
http://www.cydnidae.uni.opole.pl/biblio ... ootaxa.pdf
Pozdrawiam.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 09:56 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
To fajna praca, ale pozytywny wynik dla niespełna co czwartego okazu.
Dla starych materiałów to już i tak spory sukces, że cokolwiek się udało z nich wyciągnąć.
Jeżeli metodyka zakład zniszczenie okazu muzealnego podczas próby wyekstrahowania z niego DNA i jest na to niecałe 25% szans to decyzja musi być moim zdaniem mądrze podjęta. Jak to kilka okazów z serii kilkudziesięciu to pewnie nikt nie będzie robił problemów. Jeżeli to jednak typ... no to klops.
Choć znam entomologów, którzy twierdzą, że z okazu w muzeum nie ma żadnego pożytku jeżeli to tylko zdefragmentowana suszka i należy przynajmniej próbować wyciągnąć z niego DNA. Może i prawda, ale jednak jeżeli nic nie wyjdzie to okaz będzie stracony bezpowrotnie.
W przypadku typu ja bym absolutnie nie ryzykował, chyba że ekstrakcja nie spowoduje uszkodzenia okazu. My się staramy tak robić, po ekstrakcji okaz wraca na kartonik z odpowiednią etykietą. Jest to trudne, trwa dłużej, generalnie bardzo upierdliwe, ale okaz jest.
W ten sposób można nieco zaryzykować, nawet jeżeli szanse na uzyskanie DNA są mniejsze niż 50/50.
Próbowaliśmy wyjąć DNA z jednego gatunku stonki, mieliśmy długie serie zbierane w jednej okolicy niemal 100 lat temu. Przebadaliśmy kilkanaście okazów i pozytywny efekt udało się uzyskać tylko z jednego okazu... Więc może zależy to trochę od szczęścia ;)
Z drugiej strony ciekawe od czego zależy sukces takiej operacji, są jakieś zależności?. Dlaczego z jednych gatunków da się elegancko wyjąć DNA nawet po wielu latach, a z innych nie? Czy jakieś grupy taksonomiczne na poziomie rodzin są jakieś "łatwiejsze"? Zależy to od sposobu trucia (można założyć w jakich latach co stosowano do zatruwania owadów), czy może przechowywania?

Podana wyżej praca to niestety tylko abstrakt, a nie pełen tekst, ale na pewno jest tam to jakoś wyjaśnione.

Jak ktoś znajdzie jeszcze coś fajnego na ten temat to podzielcie się ;)


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 10:33 
Offline

Dołączył(a): piątek, 7 sty 2011, 19:33
Posty: 57
Lokalizacja: Opole
Specjalność:
Jeżeli ktoś jest zainteresowany to proszę o adres i wyślę cały tekst.
Co do niszczenia okazów: po wydobyciu tkanki mięśniowej do izolacji DNA
pozostałości umieszczamy w alkoholu i przechowujemy w zamrażarkach
do ewentualnych dalszych badań- jest to tzw. voucher.
Z doświadczenia wiem, że najtrudniej uzyskać pozytywny wynik uzyskania
DNA z okazów muzealnych, które  były poddawane zabiegom konserwacyjnym.
Czasami widać to już w czasie preparowania gdy mięśnie otoczone są czymś w rodzaju
błonki. Po wykonaniu kilkuset preparacji już na tym etapie można domniemywać czy coś z tego wyjdzie.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 12:41 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Jacek Kurzawa napisał(a):
http://allegro.pl/rozpuszczalnik-spirytus-ao-1-alkohol-absolutny-1l-i5837983432.html
Jest to:
Alkohol etylowy 99,9%
metyloetyloketon 1l/100 dm³
benzoesan denatonium 1g/100 dm³

czyli 1/100 częsci metyloetyloketonu oraz 0,01 grama benzoesan denatonium. Domieszki są więc bardzo niewielkie.

Problem jest w tym, na ile metyloetyloketon (methyl ethyl ketone, keton etylowo-metylowy, butanon) i benzoesan denatonium reagują z białkiem i mogą wpłynąć na wyniki DNA.

Pierwszy jest rozpuszczalnikiem żywic syntetycznych a drugi jest najbardziej gorzką ze wszystkich znanych substancji. Jak widać, rozpuszczalnik jest po to, by rozpuścić ten gorzki benzoesan denatonium. Podejrzewam i tu proszę o pomoc chemików, że benzoesan denatonium trudno się rozpuszcza i może być dla białek obojętny, jego domieszka jest podyktowana tym, by spirytus (alkohol etylowy) nie nadawał się do celów spożywczych. Oczywiście innym powodem zanieczyszczania bedzie też ominiecie akcyzy, ale mnie interesuje wpływ tych dwóch substancji na białka.
Oczywistym jest dla mnie, że do wykonania płynu Pampela użycie tego spirytusu będzie dużo tańsze niż spożywczego, obarczonego akcyzą. Jak natomiast BUTANON i Benzoesan denatonium mogą zadziałać na DNA?

Zmniejszenie kosztów przy uzyciu tego spirytusu jest 10-krotne.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: poniedziałek, 7 gru 2015, 13:13 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Spirytus 99,9 cz.d.a. można kupić w półlitrowych butelkach. Do tego dwumililitrowe fiolki, to wystarczy na 250 prób. Jeśli alkohol rozcieńczysz (ja tak robiłem) do 75% to prób będzie znacznie więcej. W tym wypadku wszelkie oszczędności mogą "położyć" cały materiał. Fiolki też muszą być idealne, trzeba też pamiętać, żeby materiału nie wrzucać jakąś ubabraną pęsetą.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 00:03 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Grzegorz Banasiak napisał(a):
W tym wypadku wszelkie oszczędności mogą "położyć" cały materiał.

Czy to wiadomo, że domieszka np. butanon i benzoesan denatonium mogą popsuć próbę, bo o to pytam, czy to tylko tak "na wszelki wypadek", bo wiadomo, że czysty alkohol jest najlepszy? Bo to wiadomo i nie ma wątpliwości, ale pytanie jest o to, co by było, gdyby użyć zanieczyszczonego w takim stopniu jak wyżej.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 00:28 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Ja myślę, że trzymanie się standardów, wypracowanych, sprawdzonych i przetestowanych jest najlepsze. Owszem, można testować i próbować inne opcje ale jak sam wiesz w tej dziedzinie raczkujemy... a kto wie czy dopiero nie gaworzymy (przenosząc dziecięcy rozwój na niwę sekwencjonowania DNA :-) )


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 00:32 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Zgadzam się w 100%  - najlepiej trzymać się standardów. Pytanie o dopuszczalne zanieczyszczenia jednak pozostawiam otwarte, bo jak nie wiadomo to znaczy że nie wiadomo.

PS. W sumie Miłosz wszystko napisał viewtopic.php?p=220275#p220275

PS2. Doczytalem w sieci np tu, że jednak ta czystośc alkoholu ma podstawowe znaczenie dla jakości wyników.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 00:45 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Grzegorz Banasiak napisał(a):
Jeśli alkohol rozcieńczysz (ja tak robiłem) do 75% to prób będzie znacznie więcej.

A to ciekawe, bo do tej pory spotkałem się tylko z mozliwością stosowania do DNA spirytusu 99 cz d.a lub 95%, ale nigdy mniej.
To można tak użyć 75%?

(wyjdzie o 1/3 więcej płynu => do 100 częsci spirytusu 99% należy dodać 32 cz wody aby uzyskać 75% spirytus, razem będzie 132 czesci czyli 132% objetości). Dobrze policzyłem :-)  8)  ?


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 07:10 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
O 75% pisał Lech kilkanaście postów wyżej.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 09:46 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Grzegorz Banasiak napisał(a):
O 75% pisał Lech kilkanaście postów wyżej.

Tak, ale raczej (?!) w kontekście okazów do preparacji:
Lech Borowiec napisał(a):
Robią analizy i ze zwykłych materiałów z 75% alkoholu jak i z suchych mrówek na szpilkach. Mają procedury na długie sekwencje genów jądrowych, mitochondrialnych i rybosomowych. Czułość nowych procedur i używanych starterów pozwala na dość dokładne izolowanie i sekwencjonowanie DNA z różnych materiałów. Zdarzają się niewypały, ale stosunkowo rzadko. Ja zbieram mrówki do 75% alkoholu, ale robionego wyłącznie z alkoholu absolutnego

Ale kilka postów wczesniej Lech Borowiec pisze:
Lech Borowiec napisał(a):
(sam zbieram mrówki do 75% alkoholu, bo są wtedy łatwiejsze do preparacji, nie sztywnieją tak mocno).

"nie sztywnieją..." to chyba w kontekście preparowania okazów? Pomijając wyjatkowe przypadki, że ktoś bada możliwości badań DNA na materiałach starych, suchych i na akloholu zanieczyszczonym w wiekszości przypadków zalecenia, z jakimi siędotąd spotkałem były na alkohol 99% cz d.z bądź też 95%. Ale nie 75% do DNA. Jesli ktoś potwierdzi że na 75% można pracować, to ja to chętnie odnotuję.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 10:57 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 23:27
Posty: 3778
Lokalizacja: Skierniewice
UTM: DC45
poziom: zaawansowany
Specjalność:
Ja przynajmniej tak to zrozumiałem, że z 75% alkoholu też da się zrobić sekwencjonowanie. W gruncie rzeczy chodzi o to, że zachowując odpowiednią czystość przy standardowym zbieraniu materiału do 75% alkoholu (sporządzanego z 99,9 cz.d.a.) da się ten materiał wykorzystać w badaniach DNA. Pisałeś o oszczędnościach i ta wersja wydaje się optymalna. Wprawdzie sekwencjonowanie w USA i w Polsce to zapewne różnica (w dostępności do sprzętu i gotówki na badania) ale może i u nas będzie powszechniej z czasem.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: wtorek, 8 gru 2015, 17:05 
Online

Dołączył(a): wtorek, 25 maja 2004, 12:36
Posty: 815
Specjalność:
Tak jak pisałem wcześniej jest duży postęp w ekstrakcji i sekwencjonowaniu DNA, że wiele zastrzeżeń co do procedur sprzed lat nie jest już aktualnych. Ja zbieram w tej chwili materiał tylko do 75% alkoholu (czystego), zarówno do preparacji jak i badań DNA. Marek (mój syn) robi bardzo zaawansowane prace na DNA błonkówek wykorzystując również okazy, które mu dostarczam. Niektóre pochodziły ze zbiorów sprzed 5-6 lat z alkoholu skażonego i też udawało mu się bez problemu uzyskiwać "dobre" DNA do badań. Załączam pracę jego współautorstwa, jest tam odnośnik do procedur. W błonkówkach jest to dużo łatwiejsze niż w chrząszczach. DNA ekstrahują bez uszkadzania okazów tak, że rzadkie okazy wracają do zbioru praktycznie bez śladu uszkodzeń.


Załączniki:
Johnson et al_2015_Phylogenomics resolves Evolutionary relationships among ants_low.pdf [233.72 KiB]
Pobrane 36 razy
Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: środa, 9 gru 2015, 09:08 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
U chrząszczy też można pozyskiwać DNA bez uszkadzania okazów i tak właśnie z ekipą robimy.
Kąpiel w enzymach i innych koniecznych substancjach trwa wtedy nieco dłużej. Czasem, jak jest małe ryzyko, że okaz się rozpadnie pomagamy mu vortexem (wstrząsarka). Okaz następnie wraca na kartonik do tego etykieta, że posłużył on do takiej procedury.
Jest z tym więcej roboty więc nie zawsze tak robimy, szczególnie gdy mamy długie serie okazów z tego samego stanowiska, a do badań nie potrzebujemy zwykle więcej jak pięć sztuk. Procedura jest niestandardowa i stosowana trochę na wyczucie przez naszego genetyka, ale wyczucie ma on świetne i już wiele razy okazało się, że dobrze zrobiliśmy zostawiając okaz, bo nagle okazywało się, że nie do końca wiadomo jaki to był gatunek... Szczególnie dobrze jest to robić w przypadku grup krytycznych, tak jak ostatnio mieliśmy z gatunkami z kompleksu Cryptocephalus flavipes, gdzie nagle się okazywało, że klucze i "oficjalne" dane swoje, a genetyka swoje, no i musieliśmy wrócić do źródła, czyli do okazów, aby to jakoś ze sobą pogodzić. No i się udało, sporo nowych wyników, sporo zmian i artykuł w drodze ;)


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: środa, 9 gru 2015, 15:44 
Online

Dołączył(a): wtorek, 4 gru 2007, 13:09
Posty: 4336
Lokalizacja: Hańsk
UTM: FB68
Specjalność: Sesiidae
Miłosz Mazur napisał(a):
U chrząszczy też można pozyskiwać DNA bez uszkadzania okazów i tak właśnie z ekipą robimy.
Kąpiel w enzymach i innych koniecznych substancjach trwa wtedy nieco dłużej. Czasem, jak jest małe ryzyko, że okaz się rozpadnie pomagamy mu vortexem (wstrząsarka). Okaz następnie wraca na kartonik do tego etykieta, że posłużył on do takiej procedury.

Zatem rozumiem że do badań mogą być wykorzystane okazy zasuszone, niekoniecznie pozyskane i przechowywane w alkoholu?.


Góra
 Zobacz profil  
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: środa, 9 gru 2015, 16:44 
Offline

Dołączył(a): piątek, 7 sty 2011, 19:33
Posty: 57
Lokalizacja: Opole
Specjalność:
Jak najbardziej. W moim poście nieco wyżej w tym wątku, podałem przykład takich badań.
Na wszelki wypadek powtarzam: http://www.cydnidae.uni.opole.pl/biblio ... ootaxa.pdf
Jeżeli praca wzbudzi zainteresowanie to na podany adres wyślę ją w całości.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: środa, 9 gru 2015, 19:40 
Offline
Avatar użytkownika

Dołączył(a): czwartek, 26 sty 2006, 11:33
Posty: 2564
Lokalizacja: Kędzierzyn-Koźle/Opole
UTM: CA08
Poprzedni(e) login(y): Curculio
Specjalność: Curculionoidea
inne zainteresowania: Muzyka metalowa, fantastyka, gry planszowe
Cytuj:
Zatem rozumiem że do badań mogą być wykorzystane okazy zasuszone, niekoniecznie pozyskane i przechowywane w alkoholu?.


Tak, ale tak jak pisałem wcześniej i ja i "karaczan" efekty są różne i nie zawsze zgodne z oczekiwaniami. Wszystko zależy od wielu czynników: wieku okazu, sposobu zabicia zwierza, warunków przechowywania, zastosowanej techniki no i przede wszystkim oczekiwanego efektu. Po co nam to DNA i do jakich badan ma nam posłużyć bo zupełnie inaczej prowadzi się procedurę chcąc jedynie uzyskać barkod do identyfikacji gatunku, inaczej jak do badań filogeograficznych, a jeszcze trochę inaczej do filogenetycznych. Zależy to też od samego taksonu, bo nie każdy jest "wdzięcznym" obiektem dla genetyka.

Często z takiego suchego materiału otrzymuje się jakieś sekwencje, ale są one do niektórych celów nieprzydatne. Tak bywało u nas, gdy otrzymywaliśmy DNA "posiekane" na krótkie odcinki, których nie dało się wykorzystać do naszych celów (filogeografia).
Są metody "sklejania" takich fragmentów, można stosować inne metody niż tradycyjny PCR (np mikrosatelity), ale są to techniki trudne, drogie i nie zawsze się udają. My stwierdziliśmy, że gra nie warta świeczki i analizując kilkanaście suszek w jednej trafiliśmy w sedno, ale mieliśmy szczęście mieć długa serie okazów z jednego miejsca.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 10 gru 2015, 17:12 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Jakie są możliwości zastąpienia etanolu znacznie tanszym metanolem? Na czym polega róznica w działaniu metanolu na białko, że powszechnie używany jest etanol?  Myślę o przejściu na metanol przy przechowywaniu larw. Czysty 99,99% metanol mam w domu, jest dostępny i tani. Pytanie tylko, na ile inaczej zadziała. A może po prostu to duża toksyczność metanolu (silnie trujący) jest powodem, że używa się bezpieczniejszego etanolu?


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 10 gru 2015, 19:27 
Online
Avatar użytkownika

Dołączył(a): środa, 14 gru 2011, 10:29
Posty: 1083
Specjalność:
Metanol czasami się wykorzystuje w badaniach cytologicznych do utrwalania w kompozycji z octanem etylu. Ale w konserwacji materiału się go nie wykorzystuje, ponieważ produktami jego degradacji jest aldehyd mrówkowy (formaldehyd) i kwas mrówkowy oba uszkadzają struktury białkowe, degradują DNA , więc zachowanie materiału genetycznego w postaci nieuszkodzonej jest problematyczne. Etanol w taki sposób nie degraduje DNA.


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 10 gru 2015, 20:08 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Zatem do DNA nie można go zastosować  :birra:  natomiast do konserwacji i przechowywania larw wydaje się dobrym zamiennikiem, o ile nie ma jakichś przeciwskazań?


Góra
 Zobacz profil WWW 
 
 Tytuł: Re: Sekwencjonowanie DNA, kariotyp, chromosomy
PostNapisane: czwartek, 10 gru 2015, 20:22 
Online
Avatar użytkownika

Dołączył(a): środa, 14 gru 2011, 10:29
Posty: 1083
Specjalność:
Wydaje się, że nie ma przeciwskazań, juz Jaroslav Hasek w ,,Przygodach Szwejka" opisywał wydarzenie wypicia metanolu z preparatów w sanockim gimnazjum. A jest to fakt historycznie potwierdzony  :mrgreen: Czyli preparaty były konserwowane metanolem, a kwestia toksyczności hmmm :-) konserwować można...


Góra
 Zobacz profil WWW 
 
 Tytuł: Zbieranie materiału do badań DNA
PostNapisane: czwartek, 7 wrz 2017, 12:51 
Offline
Avatar użytkownika

Dołączył(a): poniedziałek, 2 lut 2004, 19:35
Posty: 6366
Lokalizacja: Tomaszów Mazowiecki
UTM: DC30
poziom: zaawansowany
Specjalność: Cerambycidae
inne zainteresowania: Muzyka, informatyka, makrofotografia.
Ciekawy i użyteczny link wpadł mi w ręce więc odaję dalej ku uciesze tych, którzy myślą o zbieraniu materiału do badań DNA.

Załączam PDF

https://subulatepalpomere.com/2013/04/1 ... a-studies/


Załączniki:
How to collect beetles for DNA studies.pdf [410.62 KiB]
Pobrane 17 razy
Góra
 Zobacz profil WWW 
 
Wyświetl posty nie starsze niż:  Sortuj wg  
Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 55 ] 

Strefa czasowa: UTC + 1


Kto przegląda forum

Użytkownicy przeglądający ten dział: Brak zidentyfikowanych użytkowników i 3 gości


Nie możesz rozpoczynać nowych wątków
Nie możesz odpowiadać w wątkach
Nie możesz edytować swoich postów
Nie możesz usuwać swoich postów
Nie możesz dodawać załączników

Szukaj:
Skocz do:  

Protected by Anti-Spam ACPPowered by phpBB® Forum Software © phpBB Group